Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 502752
End position: 502776
Length: 25

DNA sequence
>NC_017252, from 502752 to 502776 (25 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) AAAAAAATAAATAAAAAAACAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 501742-503514	Sequence	CWQ_02450 - exodeoxyribonuclease V 67 kDa polypeptide