Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 512932
End position: 512961
Length: 30

DNA sequence
>NC_017252, from 512932 to 512961 (30 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) GTTTTATTTTGTTTTAATATATTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 512341-513513	Sequence	CWQ_02505 - putative molybdenum cofactor-binding oxidoreductase (YagR) (Protein is coded in complementary strand; from 513513 to 512341)