Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 60560
End position: 60583
Length: 24

DNA sequence
>NC_017252, from 60560 to 60583 (24 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) CTGCATCTTCATCTGTATCTGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 58957-60795	Sequence	CWQ_00275 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 60795 to 58957)