Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 62694
End position: 62717
Length: 24

DNA sequence
>NC_017252, from 62694 to 62717 (24 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) ATATAATTTTATAATTATAGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 60963-62696	Sequence	CWQ_00280 - DNA primase (Protein is coded in complementary strand; from 62696 to 60963)