Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 640538
End position: 640567
Length: 30

DNA sequence
>NC_017252, from 640538 to 640567 (30 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTTTTGATATTTTCTTATATTTTTAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 639514-640875	Sequence	CWQ_03210 engA GTP-binding protein EngA (Protein is coded in complementary strand; from 640875 to 639514)