Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 9581
End position: 9607
Length: 27

DNA sequence
>NC_017252, from 9581 to 9607 (27 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TAATTTTTTTAAATTTTTTAAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8923-11334	Sequence	CWQ_00055 - DNA gyrase subunit B (Protein is coded in complementary strand; from 11334 to 8923)