Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 309762
End position: 309786
Length: 25

DNA sequence
>NC_017254, from 309762 to 309786 (25 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) AAAAAACAAAAAGAAAAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 309469-310557	Sequence	CWU_01845 - putative periplasmic protease