Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 13625
End position: 13648
Length: 24

DNA sequence
>NC_017254, from 13625 to 13648 (24 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) ATTTTTATTATTATTATTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 12558-13922	Sequence	CWU_00060 dnaA chromosomal replication initiation protein (Protein is coded in complementary strand; from 13922 to 12558)