Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 232760
End position: 232789
Length: 30

DNA sequence
>NC_017254, from 232760 to 232789 (30 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) TTTTTTATTTCTTTTTTTATTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 232688-233794	Sequence	CWU_01365 - cell division protein FtsZ (Protein is coded in complementary strand; from 233794 to 232688)