Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 238142
End position: 238166
Length: 25

DNA sequence
>NC_017254, from 238142 to 238166 (25 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) TTTATTATATTTTTTTTTAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 237768-238832	Sequence	CWU_01395 murG undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase (Protein is coded in complementary strand; from 238832 to 237768)