Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 353020
End position: 353043
Length: 24

DNA sequence
>NC_017254, from 353020 to 353043 (24 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) ATTATGAATATGATTATGATTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 353015-353731	Sequence	CWU_02075 - high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 353731 to 353015)