Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 418771
End position: 418803
Length: 33

DNA sequence
>NC_017254, from 418771 to 418803 (33 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) CTCTATTTTTTCTATATTTTTTATGTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 416582-419176	Sequence	CWU_02470 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 419176 to 416582)