Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 442092
End position: 442118
Length: 27

DNA sequence
>NC_017254, from 442092 to 442118 (27 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) AAAAGAAAAACAAGAAAAAATAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 441047-443683	Sequence	CWU_02620 alaS alanyl-tRNA synthetase