Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 494895
End position: 494919
Length: 25

DNA sequence
>NC_017254, from 494895 to 494919 (25 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) ATAAAAAAAAATAAGATAATATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 494064-494909	Sequence	CWU_02960 - mechanosensitive channel MscS