Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 502734
End position: 502758
Length: 25

DNA sequence
>NC_017254, from 502734 to 502758 (25 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) AAAAAAATAAATAAAAAAACAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 501724-503493	Sequence	CWU_02995 - exodeoxyribonuclease V 67 kDa polypeptide