Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 519896
End position: 519919
Length: 24

DNA sequence
>NC_017254, from 519896 to 519919 (24 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) AGAAAAATAAAAAAATAAAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 519377-520519	Sequence	CWU_03110 - trigger factor