Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 608754
End position: 608783
Length: 30

DNA sequence
>NC_017254, from 608754 to 608783 (30 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) TTTAAATAATTATAAATATTTTGAGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 608679-610328	Sequence	CWU_03695 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 610328 to 608679)