Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 640539
End position: 640568
Length: 30

DNA sequence
>NC_017254, from 640539 to 640568 (30 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) TTTTTTGATATTTTCTTATATTTTTAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 639551-640876	Sequence	CWU_03890 engA GTP-binding protein EngA (Protein is coded in complementary strand; from 640876 to 639551)