Sequence retrieval

Genome: Buchnera aphidicola str. JF98 (Acyrthosiphon pisum)
Start position: 9573
End position: 9599
Length: 27

DNA sequence
>NC_017254, from 9573 to 9599 (27 bp); Buchnera aphidicola str. JF98 (Acyrthosiphon pisum) TAATTTTTTTAAATTTTTTAAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8915-11326	Sequence	CWU_00050 - DNA gyrase subunit B (Protein is coded in complementary strand; from 11326 to 8915)