Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 13627
End position: 13650
Length: 24

DNA sequence
>NC_017255, from 13627 to 13650 (24 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) ATTTTTATTATTATTATTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 12560-13924	Sequence	CWO_00060 dnaA chromosomal replication initiation protein (Protein is coded in complementary strand; from 13924 to 12560)