Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 161807
End position: 161842
Length: 36

DNA sequence
>NC_017255, from 161807 to 161842 (36 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) CACCAAAAATATCACCAAAAACATCCCCAAAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 160990-162123	Sequence	CWO_00770 - chaperone protein DnaJ (Protein is coded in complementary strand; from 162123 to 160990)