Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 172982
End position: 173006
Length: 25

DNA sequence
>NC_017255, from 172982 to 173006 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTTTTTATTTTTCTTTTTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 172157-173125	Sequence	CWO_00810 - NADH dehydrogenase subunit H