Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 200913
End position: 200937
Length: 25

DNA sequence
>NC_017255, from 200913 to 200937 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTTTTATTTTTTCTATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 200581-201147	Sequence	CWO_00940 - heat shock protein GrpE2 (Protein is coded in complementary strand; from 201147 to 200581)