Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 211435
End position: 211464
Length: 30

DNA sequence
>NC_017255, from 211435 to 211464 (30 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTTTTATAATTTTTTCTATTTCTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 209273-211723	Sequence	CWO_00990 thrA bifunctional aspartokinase I/homoserine dehydrogenase I (Protein is coded in complementary strand; from 211723 to 209273)