Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 232731
End position: 232760
Length: 30

DNA sequence
>NC_017255, from 232731 to 232760 (30 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTTTATTTCTTTTTTTATTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 232659-233813	Sequence	CWO_01090 - cell division protein FtsZ (Protein is coded in complementary strand; from 233813 to 232659)