Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 238113
End position: 238137
Length: 25

DNA sequence
>NC_017255, from 238113 to 238137 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTATTATATTTTTTTTTAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 237739-238803	Sequence	CWO_01115 murG undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase (Protein is coded in complementary strand; from 238803 to 237739)