Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 285455
End position: 285478
Length: 24

DNA sequence
>NC_017255, from 285455 to 285478 (24 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTATTTTTTGATTTTTCTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 284674-285618	Sequence	CWO_01355 - signal peptidase I (Protein is coded in complementary strand; from 285618 to 284674)