Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 309714
End position: 309738
Length: 25

DNA sequence
>NC_017255, from 309714 to 309738 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) AAAAAACAAAAAGAAAAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 309421-310509	Sequence	CWO_01480 - putative periplasmic protease