Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 337572
End position: 337595
Length: 24

DNA sequence
>NC_017255, from 337572 to 337595 (24 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) AATAATAAAAATAATAATAATAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 337030-338292	Sequence	CWO_01580 - 2-oxoglutarate dehydrogenase E2 component