Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 353040
End position: 353063
Length: 24

DNA sequence
>NC_017255, from 353040 to 353063 (24 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) ATTATGAATATGATTATGATTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 353035-353751	Sequence	CWO_01660 - high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 353751 to 353035)