Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 411152
End position: 411178
Length: 27

DNA sequence
>NC_017255, from 411152 to 411178 (27 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) GCTCGACCTGCTCGACCTGCTCGACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 410378-412183	Sequence	CWO_01965 - ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 412183 to 410378)