Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 41630
End position: 41659
Length: 30

DNA sequence
>NC_017255, from 41630 to 41659 (30 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTTTCTATTTCTTTTTTTTTGTCTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 40641-44669	Sequence	CWO_00170 rpoB DNA-directed RNA polymerase subunit beta (Protein is coded in complementary strand; from 44669 to 40641)