Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 418836
End position: 418868
Length: 33

DNA sequence
>NC_017255, from 418836 to 418868 (33 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) CTCTATTTTTTCTATATTTTTTATGTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 416647-419241	Sequence	CWO_01990 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 419241 to 416647)