Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 442149
End position: 442175
Length: 27

DNA sequence
>NC_017255, from 442149 to 442175 (27 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) AAAAGAAAAACAAGAAAAAATAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 441104-443740	Sequence	CWO_02130 alaS alanyl-tRNA synthetase