Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 494949
End position: 494973
Length: 25

DNA sequence
>NC_017255, from 494949 to 494973 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) ATAAAAAAAAATAAGATAATATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 494118-494963	Sequence	CWO_02385 - mechanosensitive channel MscS