Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 502788
End position: 502812
Length: 25

DNA sequence
>NC_017255, from 502788 to 502812 (25 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) AAAAAAATAAATAAAAAAACAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 501778-503586	Sequence	CWO_02410 - exodeoxyribonuclease V 67 kDa polypeptide