Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 512962
End position: 512991
Length: 30

DNA sequence
>NC_017255, from 512962 to 512991 (30 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) GTTTTATTTTGTTTTAATATATTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 512371-513543	Sequence	CWO_02465 - putative molybdenum cofactor-binding oxidoreductase (YagR) (Protein is coded in complementary strand; from 513543 to 512371)