Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 608792
End position: 608821
Length: 30

DNA sequence
>NC_017255, from 608792 to 608821 (30 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TTTAAATAATTATAAATATTTTGAGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 608717-610366	Sequence	CWO_03000 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 610366 to 608717)