Sequence retrieval

Genome: Buchnera aphidicola str. LL01 (Acyrthosiphon pisum)
Start position: 9574
End position: 9600
Length: 27

DNA sequence
>NC_017255, from 9574 to 9600 (27 bp); Buchnera aphidicola str. LL01 (Acyrthosiphon pisum) TAATTTTTTTAAATTTTTTAAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8916-11327	Sequence	CWO_00050 - DNA gyrase subunit B (Protein is coded in complementary strand; from 11327 to 8916)