Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1020500
End position: 1020529
Length: 30

DNA sequence
>NC_017279, from 1020500 to 1020529 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTTTTTCTTGTTTTTTGTTTTTCTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1018572-1021508	Sequence	CJSA_1027 mfd transcription-repair coupling factor (Protein is coded in complementary strand; from 1021508 to 1018572)