Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1056456
End position: 1056485
Length: 30

DNA sequence
>NC_017279, from 1056456 to 1056485 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 AAAAAAATAAAAAATAAGAAAAAAACAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1054978-1056750	Sequence	CJSA_1062 pglF UDP-GlcNAc C4,6 dehydratase (Protein is coded in complementary strand; from 1056750 to 1054978)