Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1108995
End position: 1109018
Length: 24

DNA sequence
>NC_017279, from 1108995 to 1109018 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTATATTTATATTCATATTCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1108974-1110602	Sequence	CJSA_1116 - hypothetical protein (Protein is coded in complementary strand; from 1110602 to 1108974)