Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1162558
End position: 1162584
Length: 27

DNA sequence
>NC_017279, from 1162558 to 1162584 (27 bp); Campylobacter jejuni subsp. jejuni IA3902 GGTTTTGGAGGATTTGGAGGTTTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1162205-1163098	Sequence	CJSA_1167 cbpA co-chaperone protein DnaJ