Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1349243
End position: 1349272
Length: 30

DNA sequence
>NC_017279, from 1349243 to 1349272 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTGTTTTTATCTCTTTTTATTTTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1349142-1350263	Sequence	CJSA_1343 - hypothetical protein (Protein is coded in complementary strand; from 1350263 to 1349142)