Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1450657
End position: 1450686
Length: 30

DNA sequence
>NC_017279, from 1450657 to 1450686 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 AAAAAATTTAAAAGAATTAAAAGAAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1450602-1450823	Sequence	CJSA_1438 moaD putative molybdopterin converting factor,subunit 1