Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1572719
End position: 1572743
Length: 25

DNA sequence
>NC_017279, from 1572719 to 1572743 (25 bp); Campylobacter jejuni subsp. jejuni IA3902 TATAATTTAATATCATATCATAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1572732-1573490	Sequence	CJSA_1563 map methionine aminopeptidase (Protein is coded in complementary strand; from 1573490 to 1572732)