Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 1586098
End position: 1586124
Length: 27

DNA sequence
>NC_017279, from 1586098 to 1586124 (27 bp); Campylobacter jejuni subsp. jejuni IA3902 CGATGCAAACGATGCAAACGATGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1585824-1586327	Sequence	CJSA_1576 - putative lipoprotein thiredoxin