Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 279759
End position: 279788
Length: 30

DNA sequence
>NC_017279, from 279759 to 279788 (30 bp); Campylobacter jejuni subsp. jejuni IA3902 AAAGACTAAAAAGTACTAAAAAAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 279728-280402	Sequence	CJSA_0275 modB molybdate transport system permease protein (Protein is coded in complementary strand; from 280402 to 279728)