Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 310433
End position: 310456
Length: 24

DNA sequence
>NC_017279, from 310433 to 310456 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTTTAATTTTACTTTTAATTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 310393-313032	Sequence	CJSA_0312 polA DNA polymerase I (Protein is coded in complementary strand; from 313032 to 310393)