Sequence retrieval

Genome: Campylobacter jejuni subsp. jejuni IA3902
Start position: 329235
End position: 329258
Length: 24

DNA sequence
>NC_017279, from 329235 to 329258 (24 bp); Campylobacter jejuni subsp. jejuni IA3902 TTTCTGTTTCTTTGTCTGTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 328826-329497	Sequence	CJSA_0329 - DNA-binding response regulator (Protein is coded in complementary strand; from 329497 to 328826)